Transcript: Human NM_032101.3

Homo sapiens protocadherin gamma subfamily B, 7 (PCDHGB7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
PCDHGB7 (56099)
Length:
2760
CDS:
184..2610

Additional Resources:

NCBI RefSeq record:
NM_032101.3
NBCI Gene record:
PCDHGB7 (56099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032101.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433399 TGCACATTACTGACGTCAATG pLKO_005 1502 CDS 100% 10.800 15.120 N PCDHGB7 n/a
2 TRCN0000056199 CGTTGCCCTATGCCTATAATT pLKO.1 2423 CDS 100% 15.000 12.000 N PCDHGB7 n/a
3 TRCN0000056198 CGGTGTAAAGTAATTGTAGAA pLKO.1 1171 CDS 100% 4.950 3.960 N PCDHGB7 n/a
4 TRCN0000416257 AGTAGAGGTGTTCCATTTAAG pLKO_005 1342 CDS 100% 13.200 9.240 N PCDHGB7 n/a
5 TRCN0000423115 GTAGAAAGATATACGATAAAC pLKO_005 1117 CDS 100% 13.200 9.240 N PCDHGB7 n/a
6 TRCN0000445499 CAAGAGGTACTGCCGGATTTC pLKO_005 2188 CDS 100% 10.800 7.560 N PCDHGB7 n/a
7 TRCN0000056200 CCGGAAAGATGAAATAAACTT pLKO.1 582 CDS 100% 5.625 3.938 N PCDHGB7 n/a
8 TRCN0000056202 GAAGCAGATAAGAAGATTCTT pLKO.1 2572 CDS 100% 5.625 3.938 N PCDHGB7 n/a
9 TRCN0000056201 GCTCAGATAAGAATCCTGGTA pLKO.1 859 CDS 100% 2.640 1.848 N PCDHGB7 n/a
10 TRCN0000094725 GCCCAGAAATAATCATCACTT pLKO.1 1214 CDS 100% 4.950 2.475 Y Pcdhgb7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032101.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.