Transcript: Human NM_032271.3

Homo sapiens TNF receptor associated factor 7 (TRAF7), mRNA.

Source:
NCBI, updated 2019-05-19
Taxon:
Homo sapiens (human)
Gene:
TRAF7 (84231)
Length:
3683
CDS:
116..2128

Additional Resources:

NCBI RefSeq record:
NM_032271.3
NBCI Gene record:
TRAF7 (84231)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032271.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056948 CGGGACGCATCCATGTTAAAT pLKO.1 1181 CDS 100% 15.000 21.000 N TRAF7 n/a
2 TRCN0000056949 CTACTCCATTGCTGTGACAAA pLKO.1 1801 CDS 100% 4.950 3.465 N TRAF7 n/a
3 TRCN0000056950 GCACTGTGAAGGTTTGGACTT pLKO.1 2103 CDS 100% 4.050 2.835 N TRAF7 n/a
4 TRCN0000056951 GACCAGAATGGAAACGACCTT pLKO.1 196 CDS 100% 2.640 1.848 N TRAF7 n/a
5 TRCN0000056952 GCTGGGAAAGCTCTCGGAGAA pLKO.1 1069 CDS 100% 1.350 0.945 N TRAF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032271.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.