Transcript: Human NM_032436.4

Homo sapiens chromosome alignment maintaining phosphoprotein 1 (CHAMP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CHAMP1 (283489)
Length:
3799
CDS:
320..2758

Additional Resources:

NCBI RefSeq record:
NM_032436.4
NBCI Gene record:
CHAMP1 (283489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032436.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150524 GCAAAGTTATTTCACTGCCAT pLKO.1 494 CDS 100% 2.640 3.696 N CHAMP1 n/a
2 TRCN0000150655 GCAAGTTGTACTCAAAGCATT pLKO.1 3056 3UTR 100% 4.950 3.960 N CHAMP1 n/a
3 TRCN0000151142 GCTTCACCTAAGAAACTCTTA pLKO.1 2123 CDS 100% 4.950 3.960 N CHAMP1 n/a
4 TRCN0000153644 CGGCATAATGAAGAGGCAAAT pLKO.1 2687 CDS 100% 10.800 7.560 N CHAMP1 n/a
5 TRCN0000158286 CCACGTTGTCTCCTGAACATT pLKO.1 1524 CDS 100% 5.625 3.938 N CHAMP1 n/a
6 TRCN0000157958 CCGTGTTTCACTGTCTCAGTT pLKO.1 2867 3UTR 100% 4.950 3.465 N CHAMP1 n/a
7 TRCN0000154064 CCTGTTTGTGAGTCTCAGAAA pLKO.1 893 CDS 100% 4.950 3.465 N CHAMP1 n/a
8 TRCN0000150656 GAACTGAAAGTCTTCCAGATT pLKO.1 3615 3UTR 100% 4.950 3.465 N CHAMP1 n/a
9 TRCN0000157557 GCACAATCTGTGGAAAGGCTT pLKO.1 2538 CDS 100% 2.640 1.848 N CHAMP1 n/a
10 TRCN0000152318 CACAGAAACTTGGTTCAGTTT pLKO.1 720 CDS 100% 0.495 0.297 N CHAMP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032436.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.