Transcript: Human NM_032482.3

Homo sapiens DOT1 like histone lysine methyltransferase (DOT1L), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
DOT1L (84444)
Length:
7652
CDS:
253..4866

Additional Resources:

NCBI RefSeq record:
NM_032482.3
NBCI Gene record:
DOT1L (84444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020209 CGCCAACACGAGTGTTATATT pLKO.1 948 CDS 100% 15.000 21.000 N DOT1L n/a
2 TRCN0000236345 TCGCCAACACGAGTGTTATAT pLKO_005 947 CDS 100% 15.000 21.000 N DOT1L n/a
3 TRCN0000236343 CACGTTGAACAAGTGCATTTA pLKO_005 5586 3UTR 100% 13.200 18.480 N DOT1L n/a
4 TRCN0000236346 ATCACTATGGCGTCGAGAAAG pLKO_005 794 CDS 100% 10.800 15.120 N DOT1L n/a
5 TRCN0000020210 CCGCAAGAAGAAGCTAAACAA pLKO.1 1434 CDS 100% 5.625 7.875 N DOT1L n/a
6 TRCN0000020212 GCAGTGCTCGAATTGAGAGAA pLKO.1 3839 CDS 100% 4.950 3.960 N DOT1L n/a
7 TRCN0000236342 CACATTGGAGAGAGGCGATTT pLKO_005 900 CDS 100% 10.800 7.560 N DOT1L n/a
8 TRCN0000236344 GCCCGCAAGAAGAAGCTAAAC pLKO_005 1432 CDS 100% 10.800 7.560 N DOT1L n/a
9 TRCN0000020213 CAGATCAGCATTGTGGAGCTA pLKO.1 2173 CDS 100% 2.640 1.848 N DOT1L n/a
10 TRCN0000020211 CCCGGATCTCAAGCTCGCTAT pLKO.1 396 CDS 100% 1.350 0.945 N DOT1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.