Transcript: Human NM_032489.3

Homo sapiens acrosin binding protein (ACRBP), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ACRBP (84519)
Length:
1905
CDS:
67..1698

Additional Resources:

NCBI RefSeq record:
NM_032489.3
NBCI Gene record:
ACRBP (84519)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032489.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371219 CGTGGAAGAGCTCCTACAATC pLKO_005 591 CDS 100% 10.800 8.640 N ACRBP n/a
2 TRCN0000115842 CTGCCCACGTTCTCTATTGTT pLKO.1 1733 3UTR 100% 5.625 4.500 N ACRBP n/a
3 TRCN0000115846 GCCCTCTCTCTCCTACCGAAT pLKO.1 173 CDS 100% 1.350 1.080 N ACRBP n/a
4 TRCN0000115845 CATTCGATCAGCCCAGGAAAT pLKO.1 930 CDS 100% 10.800 7.560 N ACRBP n/a
5 TRCN0000115843 CCTAACACTCTCAAGGAGATA pLKO.1 460 CDS 100% 4.950 3.465 N ACRBP n/a
6 TRCN0000115844 GTACCCAAACTACTGTTCCTT pLKO.1 1515 CDS 100% 0.000 0.000 N ACRBP n/a
7 TRCN0000371167 ATTTGTGACACAGACTATATC pLKO_005 1492 CDS 100% 13.200 7.920 N ACRBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032489.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.