Transcript: Human NM_032510.4

Homo sapiens par-6 family cell polarity regulator gamma (PARD6G), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PARD6G (84552)
Length:
3836
CDS:
167..1297

Additional Resources:

NCBI RefSeq record:
NM_032510.4
NBCI Gene record:
PARD6G (84552)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032510.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420163 GCAGACTGCATCCGCTCATTT pLKO_005 1358 3UTR 100% 13.200 18.480 N PARD6G n/a
2 TRCN0000427865 AGGCGGTTTCTAGTGCAAATC pLKO_005 411 CDS 100% 10.800 15.120 N PARD6G n/a
3 TRCN0000425736 GGTTGTGCACACCCACCATAT pLKO_005 310 CDS 100% 10.800 15.120 N PARD6G n/a
4 TRCN0000421901 CCTTGCGATTCTACGATTGCA pLKO_005 195 CDS 100% 3.000 4.200 N PARD6G n/a
5 TRCN0000146716 CAGTGATGTAACTATTGGCTA pLKO.1 337 CDS 100% 2.640 3.696 N PARD6G n/a
6 TRCN0000434996 AGGACAACGACGTCGTCATCG pLKO_005 1056 CDS 100% 1.350 1.890 N PARD6G n/a
7 TRCN0000148005 GCACCTGTGTTTGATGTTATT pLKO.1 3290 3UTR 100% 13.200 9.240 N PARD6G n/a
8 TRCN0000420111 GTTCTCTCTGGACCGTCATAA pLKO_005 259 CDS 100% 13.200 9.240 N PARD6G n/a
9 TRCN0000421793 AGTTGGCCCATGCAACATATC pLKO_005 1669 3UTR 100% 10.800 7.560 N PARD6G n/a
10 TRCN0000113097 GTGGAAGTCAAGAGCAAGTTT pLKO.1 221 CDS 100% 5.625 3.938 N Pard6g n/a
11 TRCN0000149232 GTGGAAGTCAAGAGCAAGTTT pLKO.1 221 CDS 100% 5.625 3.938 N PARD6G n/a
12 TRCN0000148677 CGCTGCTCTTTGTTTCAACTT pLKO.1 1407 3UTR 100% 4.950 3.465 N PARD6G n/a
13 TRCN0000147857 GAAGATTTCTACAAGCTGGTT pLKO.1 293 CDS 100% 2.640 1.848 N PARD6G n/a
14 TRCN0000433141 TGGAGGTGAACGGCATTGAGG pLKO_005 816 CDS 100% 0.880 0.616 N PARD6G n/a
15 TRCN0000429940 GCTGGCTGTGAATGACGAGGT pLKO_005 793 CDS 100% 0.720 0.504 N PARD6G n/a
16 TRCN0000147043 CCATCAACAATGATGACAACT pLKO.1 384 CDS 100% 0.495 0.347 N PARD6G n/a
17 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1876 3UTR 100% 4.950 2.475 Y ORAI2 n/a
18 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1873 3UTR 100% 4.950 2.475 Y LOC339059 n/a
19 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 2297 3UTR 100% 4.950 2.475 Y C16orf89 n/a
20 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1966 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032510.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.