Transcript: Human NM_032906.5

Homo sapiens PIGY upstream reading frame (PYURF), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PYURF (100996939)
Length:
1311
CDS:
77..421

Additional Resources:

NCBI RefSeq record:
NM_032906.5
NBCI Gene record:
PYURF (100996939)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032906.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246520 CATTGATGGGATCCCTAATAT pLKO_005 337 CDS 100% 15.000 7.500 Y Pyurf n/a
2 TRCN0000134651 GATGACACGTCAAAGTAAGAA pLKO.1 376 CDS 100% 5.625 2.813 Y PIGY n/a
3 TRCN0000133733 CTGTTCTTATTCCACTGGTTT pLKO.1 545 3UTR 100% 4.950 2.475 Y PIGY n/a
4 TRCN0000134309 GAAAGCTCAAATGGATGGAAT pLKO.1 793 3UTR 100% 4.950 2.475 Y PIGY n/a
5 TRCN0000138724 GCTAGGATGACACGTCAAAGT pLKO.1 371 CDS 100% 4.950 2.475 Y PIGY n/a
6 TRCN0000135760 CAATCATTGATGGGATCCCTA pLKO.1 333 CDS 100% 2.640 1.320 Y PIGY n/a
7 TRCN0000134500 GATCCCTAATATGATACCACA pLKO.1 346 CDS 100% 2.640 1.320 Y PIGY n/a
8 TRCN0000138877 GAAGCAAGAAGAAGTGGAGCA pLKO.1 394 CDS 100% 2.160 1.080 Y PIGY n/a
9 TRCN0000137547 CCAATCATTGATGGGATCCCT pLKO.1 332 CDS 100% 0.750 0.375 Y PIGY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032906.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.