Transcript: Human NM_032949.3

Homo sapiens protocadherin 8 (PCDH8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
PCDH8 (5100)
Length:
4797
CDS:
205..3126

Additional Resources:

NCBI RefSeq record:
NM_032949.3
NBCI Gene record:
PCDH8 (5100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032949.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435555 GACCGGTTTCAGTGTTGTATA pLKO_005 3185 3UTR 100% 13.200 18.480 N PCDH8 n/a
2 TRCN0000055867 CGCACCGCAAAGGACACGGTT pLKO.1 2080 CDS 100% 0.000 0.000 N PCDH8 n/a
3 TRCN0000412645 TTAACCTGTACATTGTGTAAT pLKO_005 3391 3UTR 100% 13.200 9.240 N PCDH8 n/a
4 TRCN0000055863 CCGCCTGATGAAGCAATTCAA pLKO.1 393 CDS 100% 5.625 3.938 N PCDH8 n/a
5 TRCN0000055864 CCAGATGTCAACCTTCTGTAA pLKO.1 2859 CDS 100% 4.950 3.465 N PCDH8 n/a
6 TRCN0000055865 AGTGATTTCAACGACAGCGAT pLKO.1 2677 CDS 100% 2.640 1.848 N PCDH8 n/a
7 TRCN0000094226 GCTGATCGTCATCATCGTGTT pLKO.1 2451 CDS 100% 4.050 2.835 N Pcdh8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032949.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.