Transcript: Human NM_033023.4

Homo sapiens platelet derived growth factor subunit A (PDGFA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PDGFA (5154)
Length:
2740
CDS:
844..1434

Additional Resources:

NCBI RefSeq record:
NM_033023.4
NBCI Gene record:
PDGFA (5154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033023.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022330 AGGACGGTCATTTACGAGATT pLKO.1 1138 CDS 100% 4.950 6.930 N LOC377602 n/a
2 TRCN0000158260 CAGGACGGTCATTTACGAGAT pLKO.1 1137 CDS 100% 4.050 5.670 N PDGFA n/a
3 TRCN0000156591 GAATCCGGATTATCGGGAAGA pLKO.1 1395 CDS 100% 4.050 5.670 N PDGFA n/a
4 TRCN0000156443 CGGTCATTTACGAGATTCCTC pLKO.1 1142 CDS 100% 2.640 3.696 N PDGFA n/a
5 TRCN0000157341 CTGAATCCGGATTATCGGGAA pLKO.1 1393 CDS 100% 2.160 3.024 N PDGFA n/a
6 TRCN0000022333 CAAGACCAGGACGGTCATTTA pLKO.1 1131 CDS 100% 13.200 10.560 N LOC377602 n/a
7 TRCN0000339543 CAAGACCAGGACGGTCATTTA pLKO_005 1131 CDS 100% 13.200 10.560 N Pdgfa n/a
8 TRCN0000157845 CACAAGCCTGAATCCGGATTA pLKO.1 1386 CDS 100% 10.800 7.560 N PDGFA n/a
9 TRCN0000157428 GTGAGGTTAGAGGAGCATTTG pLKO.1 1348 CDS 100% 10.800 7.560 N PDGFA n/a
10 TRCN0000022329 CGTAGGGAGTGAGGATTCTTT pLKO.1 999 CDS 100% 5.625 3.938 N LOC377602 n/a
11 TRCN0000158353 CAAGGTGGAATACGTCAGGAA pLKO.1 1302 CDS 100% 2.640 1.848 N PDGFA n/a
12 TRCN0000157461 GTGAGGATTCTTTGGACACCA pLKO.1 1007 CDS 100% 2.640 1.848 N PDGFA n/a
13 TRCN0000022332 CCGCAGTCAGATCCACAGCAT pLKO.1 945 CDS 100% 0.880 0.616 N LOC377602 n/a
14 TRCN0000158199 CATTCGGAGGAAGAGAAGCAT pLKO.1 1086 CDS 100% 3.000 1.800 N PDGFA n/a
15 TRCN0000065689 AGGACGGTCATTTACGAGATA pLKO.1 1138 CDS 100% 4.950 6.930 N Pdgfa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033023.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.