Transcript: Human NM_033068.3

Homo sapiens acid phosphatase 4 (ACP4), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ACP4 (93650)
Length:
1342
CDS:
1..1281

Additional Resources:

NCBI RefSeq record:
NM_033068.3
NBCI Gene record:
ACP4 (93650)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033068.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380547 GTGTTCGTGGCTCTGGTATTC pLKO_005 97 CDS 100% 10.800 15.120 N ACP4 n/a
2 TRCN0000379760 ACATCCGCAGCACGGACTTTG pLKO_005 308 CDS 100% 3.600 5.040 N ACP4 n/a
3 TRCN0000380860 TTCACGGGACTGTCGCTGGTT pLKO_005 574 CDS 100% 0.880 1.232 N ACP4 n/a
4 TRCN0000381991 AGATCTCGGCTTTGGATATTG pLKO_005 707 CDS 100% 13.200 9.240 N ACP4 n/a
5 TRCN0000381123 GCCAAAGATGGAGGGAATGTC pLKO_005 973 CDS 100% 4.950 3.465 N ACP4 n/a
6 TRCN0000380924 TCCTGCTGAATGCTATCCTTG pLKO_005 782 CDS 100% 4.050 2.835 N ACP4 n/a
7 TRCN0000381444 CCAGATGTCCTGCGGACTCTT pLKO_005 682 CDS 100% 1.650 1.155 N ACP4 n/a
8 TRCN0000382345 TATGCTGCCTGCCTCGGCTTT pLKO_005 925 CDS 100% 1.350 0.945 N ACP4 n/a
9 TRCN0000052674 ACCCACACAAGGAGGTGGCCT pLKO.1 158 CDS 100% 0.000 0.000 N ACP4 n/a
10 TRCN0000052676 CCCTGCTGGACCTCTCCTGCT pLKO.1 27 CDS 100% 0.000 0.000 N ACP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033068.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.