Transcript: Human NM_033090.3

Homo sapiens growth regulating estrogen receptor binding 1 (GREB1), transcript variant b, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
GREB1 (9687)
Length:
2386
CDS:
291..1664

Additional Resources:

NCBI RefSeq record:
NM_033090.3
NBCI Gene record:
GREB1 (9687)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033090.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000299 ACTGGCAAAGAATAACCTGTT pLKO.1 1145 CDS 100% 4.050 2.835 N GREB1 n/a
2 TRCN0000273205 ACTGGCAAAGAATAACCTGTT pLKO_005 1145 CDS 100% 4.050 2.835 N GREB1 n/a
3 TRCN0000200523 CCAGTGATATTTAAAGGCCAT pLKO.1 1434 CDS 100% 2.160 1.512 N Greb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033090.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.