Transcript: Human NM_033100.4

Homo sapiens cadherin related family member 1 (CDHR1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CDHR1 (92211)
Length:
6877
CDS:
225..2804

Additional Resources:

NCBI RefSeq record:
NM_033100.4
NBCI Gene record:
CDHR1 (92211)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033100.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053572 GTTTGGAAAGAGCGTTCAGAA pLKO.1 1949 CDS 100% 4.950 6.930 N CDHR1 n/a
2 TRCN0000442973 ACCACCCGCCAACATTCTATG pLKO_005 1267 CDS 100% 10.800 7.560 N CDHR1 n/a
3 TRCN0000419825 CTCACGTATACACCCTGAATG pLKO_005 379 CDS 100% 10.800 7.560 N CDHR1 n/a
4 TRCN0000053569 GCCAACGTGTTCGACATCAAT pLKO.1 2073 CDS 100% 5.625 3.938 N CDHR1 n/a
5 TRCN0000053571 ACGGTCAATGTGGAGGATGTT pLKO.1 921 CDS 100% 4.950 3.465 N CDHR1 n/a
6 TRCN0000053568 GCTACCAAGTTCATGCTCAAA pLKO.1 2514 CDS 100% 4.950 3.465 N CDHR1 n/a
7 TRCN0000053570 GTCCAAAGTATTAACCTTCAA pLKO.1 1523 CDS 100% 4.950 3.465 N CDHR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033100.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.