Transcript: Human NM_033274.5

Homo sapiens ADAM metallopeptidase domain 19 (ADAM19), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ADAM19 (8728)
Length:
6481
CDS:
80..2836

Additional Resources:

NCBI RefSeq record:
NM_033274.5
NBCI Gene record:
ADAM19 (8728)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033274.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047112 CCTGCTGCAATGCCTCTAATT pLKO.1 1401 CDS 100% 13.200 18.480 N ADAM19 n/a
2 TRCN0000047109 CCGCACCAAATTGCATCGTTT pLKO.1 2604 CDS 100% 4.950 6.930 N ADAM19 n/a
3 TRCN0000047111 CCATTATACTTCAAGTGGTAA pLKO.1 361 CDS 100% 4.950 3.465 N ADAM19 n/a
4 TRCN0000047108 CCGAGGAATTAGAGGACTGAT pLKO.1 475 CDS 100% 4.950 3.465 N ADAM19 n/a
5 TRCN0000047110 CCCTACCAACTTCTACCAGAT pLKO.1 1561 CDS 100% 4.050 2.835 N ADAM19 n/a
6 TRCN0000413271 GGAATTAGAGGACTGATTATA pLKO_005 479 CDS 100% 15.000 12.000 N Adam19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033274.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.