Transcript: Mouse NM_033373.1

Mus musculus keratin 23 (Krt23), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Krt23 (94179)
Length:
1560
CDS:
47..1315

Additional Resources:

NCBI RefSeq record:
NM_033373.1
NBCI Gene record:
Krt23 (94179)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033373.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091168 CGACGGAAATCCTTGGAGTTT pLKO.1 1395 3UTR 100% 4.950 3.960 N Krt23 n/a
2 TRCN0000091169 GCGTCAGAACAATGAACACAA pLKO.1 1090 CDS 100% 4.950 3.960 N Krt23 n/a
3 TRCN0000091171 AGGCAGGAATACGAGTTAATA pLKO.1 779 CDS 100% 15.000 10.500 N Krt23 n/a
4 TRCN0000091172 GAGGCAGGAATACGAGTTAAT pLKO.1 778 CDS 100% 13.200 9.240 N Krt23 n/a
5 TRCN0000091170 GATGACTTCAACCTGAAGTTT pLKO.1 509 CDS 100% 0.563 0.394 N Krt23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033373.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.