Transcript: Mouse NM_033541.4

Mus musculus 2'-5' oligoadenylate synthetase 1C (Oas1c), mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Oas1c (114643)
Length:
2286
CDS:
363..1451

Additional Resources:

NCBI RefSeq record:
NM_033541.4
NBCI Gene record:
Oas1c (114643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033541.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222675 CGTATTGATGTTGGGTAGCTT pLKO.1 1950 3UTR 100% 3.000 4.200 N Oas1c n/a
2 TRCN0000075914 CTGTCTATGTATGGGAACATT pLKO.1 1087 CDS 100% 5.625 3.938 N Oas1c n/a
3 TRCN0000075915 GTCGCCTATTACAAGAATCTT pLKO.1 1167 CDS 100% 5.625 3.938 N Oas1c n/a
4 TRCN0000075917 CCAATTCTACAACAAAGTCTA pLKO.1 866 CDS 100% 4.950 3.465 N Oas1c n/a
5 TRCN0000075916 GCCTATTACAAGAATCTTCGA pLKO.1 1170 CDS 100% 2.640 1.848 N Oas1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033541.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.