Transcript: Mouse NM_033564.3

Mus musculus Mpv17 transgene, kidney disease mutant-like (Mpv17l), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mpv17l (93734)
Length:
3328
CDS:
50..634

Additional Resources:

NCBI RefSeq record:
NM_033564.3
NBCI Gene record:
Mpv17l (93734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412330 TCAGTCATGAAGGTTGAATAA pLKO_005 1054 3UTR 100% 13.200 18.480 N Mpv17l n/a
2 TRCN0000430908 AGATTGTATTTCTAGCCTAAA pLKO_005 957 3UTR 100% 10.800 15.120 N Mpv17l n/a
3 TRCN0000098002 CAGTCCATATTCATCTTCCTT pLKO.1 575 CDS 100% 3.000 4.200 N Mpv17l n/a
4 TRCN0000098001 GCAGAAATTCTGGAATACGTA pLKO.1 406 CDS 100% 3.000 4.200 N Mpv17l n/a
5 TRCN0000098003 CCACGGAAACTTCAACTACGT pLKO.1 223 CDS 100% 2.640 2.112 N Mpv17l n/a
6 TRCN0000098000 GCCCACTTGATTTGAAATTAT pLKO.1 749 3UTR 100% 15.000 10.500 N Mpv17l n/a
7 TRCN0000430783 CTCATGTACTGGCCCTTTGTG pLKO_005 437 CDS 100% 4.950 3.465 N Mpv17l n/a
8 TRCN0000098004 GCCCACTAACGTGCTGCTCTA pLKO.1 100 CDS 100% 1.350 0.945 N Mpv17l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.