Transcript: Mouse NM_033571.3

Mus musculus FK506 binding protein 6 (Fkbp6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Fkbp6 (94244)
Length:
1447
CDS:
54..1037

Additional Resources:

NCBI RefSeq record:
NM_033571.3
NBCI Gene record:
Fkbp6 (94244)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111829 TGCAACCATGACATCAATAAT pLKO.1 906 CDS 100% 15.000 12.000 N Fkbp6 n/a
2 TRCN0000111826 CCCTGCAACCATGACATCAAT pLKO.1 903 CDS 100% 5.625 3.938 N Fkbp6 n/a
3 TRCN0000111828 CCTGTTTGAGATCGAGCTGAT pLKO.1 452 CDS 100% 4.050 2.835 N Fkbp6 n/a
4 TRCN0000111827 CGGCTGATGAAACTTGGAGAA pLKO.1 297 CDS 100% 4.050 2.835 N Fkbp6 n/a
5 TRCN0000111825 CCCTGACTGTTACTCCAGGTT pLKO.1 1155 3UTR 100% 2.640 1.848 N Fkbp6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.