Transcript: Mouse NM_033614.2

Mus musculus phosphodiesterase 6C, cGMP specific, cone, alpha prime (Pde6c), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Pde6c (110855)
Length:
2967
CDS:
166..2751

Additional Resources:

NCBI RefSeq record:
NM_033614.2
NBCI Gene record:
Pde6c (110855)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114932 CCGGATGAAATCAGCTCTATT pLKO.1 1555 CDS 100% 13.200 18.480 N Pde6c n/a
2 TRCN0000114933 CGAAACTTCAAGTGGGATTTA pLKO.1 2483 CDS 100% 13.200 18.480 N Pde6c n/a
3 TRCN0000114934 CCGTTGGACATTGGGATAGTT pLKO.1 574 CDS 100% 5.625 4.500 N Pde6c n/a
4 TRCN0000306380 ACTGACCTGGCACTCTATTTC pLKO_005 2179 CDS 100% 13.200 9.240 N Pde6c n/a
5 TRCN0000306381 AGTTAAATGTAGAGGTAATTG pLKO_005 1592 CDS 100% 13.200 9.240 N Pde6c n/a
6 TRCN0000306437 TGAGACTGGCTGGGTCATTAA pLKO_005 1299 CDS 100% 13.200 9.240 N Pde6c n/a
7 TRCN0000114931 CCCGGATGAAATCAGCTCTAT pLKO.1 1554 CDS 100% 4.950 3.465 N Pde6c n/a
8 TRCN0000332329 CCCGGATGAAATCAGCTCTAT pLKO_005 1554 CDS 100% 4.950 3.465 N Pde6c n/a
9 TRCN0000114935 GCACCAATAACTTGTACCAAA pLKO.1 1988 CDS 100% 4.950 3.465 N Pde6c n/a
10 TRCN0000332398 GCACCAATAACTTGTACCAAA pLKO_005 1988 CDS 100% 4.950 3.465 N Pde6c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.