Transcript: Human NM_033647.4

Homo sapiens DNA helicase B (HELB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
HELB (92797)
Length:
3621
CDS:
60..3323

Additional Resources:

NCBI RefSeq record:
NM_033647.4
NBCI Gene record:
HELB (92797)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033647.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153633 CCGCGTTTCTATTTGTGATGA pLKO.1 242 CDS 100% 4.950 6.930 N HELB n/a
2 TRCN0000157343 CGAGGAGCAAACAGTTGTCTA pLKO.1 2735 CDS 100% 4.950 6.930 N HELB n/a
3 TRCN0000151286 CGCGTTTCTATTTGTGATGAA pLKO.1 243 CDS 100% 4.950 6.930 N HELB n/a
4 TRCN0000151876 CGTGACTTTGAAAGTAACGTT pLKO.1 2529 CDS 100% 3.000 4.200 N HELB n/a
5 TRCN0000152703 GCTGGCTTACTAAGACAGAAA pLKO.1 1689 CDS 100% 4.950 3.960 N HELB n/a
6 TRCN0000152487 CCTTGGCATTTATGTGTCGAT pLKO.1 1182 CDS 100% 2.640 2.112 N HELB n/a
7 TRCN0000153803 CAGGACAATGGTGACCATATT pLKO.1 1323 CDS 100% 13.200 9.240 N HELB n/a
8 TRCN0000152488 CCTGGTAACTTGCTGAAAGAT pLKO.1 1947 CDS 100% 5.625 3.938 N HELB n/a
9 TRCN0000153044 GAACCTGGTAACTTGCTGAAA pLKO.1 1944 CDS 100% 4.950 3.465 N HELB n/a
10 TRCN0000152896 GTCTGATATGTCACCACCAAA pLKO.1 404 CDS 100% 4.950 3.465 N HELB n/a
11 TRCN0000152634 GTTAGAGTTCTGGTTGTGGAT pLKO.1 1809 CDS 100% 2.640 1.848 N HELB n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3506 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3506 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033647.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.