Transcript: Human NM_048368.4

Homo sapiens CTD phosphatase subunit 1 (CTDP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
CTDP1 (9150)
Length:
5703
CDS:
146..2749

Additional Resources:

NCBI RefSeq record:
NM_048368.4
NBCI Gene record:
CTDP1 (9150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_048368.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002998 ACGAGACATGGACTAGGAGTT pLKO.1 3229 3UTR 100% 4.050 5.670 N CTDP1 n/a
2 TRCN0000002997 CTATGCCAAGTATGACCGCTA pLKO.1 1957 CDS 100% 2.160 3.024 N CTDP1 n/a
3 TRCN0000378106 TGGCAGACGTGGCCATAATTT pLKO_005 2046 CDS 100% 15.000 12.000 N CTDP1 n/a
4 TRCN0000356197 CGAGAATCTCAGACGAGAAAG pLKO_005 1151 CDS 100% 10.800 8.640 N CTDP1 n/a
5 TRCN0000010751 GCACACACCATCGCAGGCTTT pLKO.1 902 CDS 100% 1.350 1.080 N CTDP1 n/a
6 TRCN0000356259 TGTCAGCAGATGTCGAATAAA pLKO_005 746 CDS 100% 15.000 10.500 N CTDP1 n/a
7 TRCN0000428141 ACTCAATGGTTTGCATTATTG pLKO_005 1029 CDS 100% 13.200 9.240 N CTDP1 n/a
8 TRCN0000002999 CAGACGAGAAAGAAAGTAAAT pLKO.1 1160 CDS 100% 13.200 9.240 N CTDP1 n/a
9 TRCN0000433579 TTGTAAGTGACAGGTGTTAAA pLKO_005 3064 3UTR 100% 13.200 9.240 N CTDP1 n/a
10 TRCN0000356258 ACTTGGACCAGACGTTGATTC pLKO_005 708 CDS 100% 10.800 7.560 N CTDP1 n/a
11 TRCN0000436164 GATGAATGTATTGACCCATTT pLKO_005 968 CDS 100% 10.800 7.560 N CTDP1 n/a
12 TRCN0000415707 TCCCTCCTAGGGAACCCATTT pLKO_005 3322 3UTR 100% 10.800 7.560 N CTDP1 n/a
13 TRCN0000002996 CGGGAAACCTTAGAAATCTCT pLKO.1 996 CDS 100% 3.000 2.100 N CTDP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_048368.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.