Transcript: Human NM_052883.2

Homo sapiens thioredoxin reductase 3 (TXNRD3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TXNRD3 (114112)
Length:
2912
CDS:
135..2066

Additional Resources:

NCBI RefSeq record:
NM_052883.2
NBCI Gene record:
TXNRD3 (114112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246173 AGCTGAAAGTGTTGGCTAAAT pLKO_005 1363 CDS 100% 13.200 18.480 N TXNRD3 n/a
2 TRCN0000246172 TGTGAAGTTCCTACGGAAATT pLKO_005 1298 CDS 100% 13.200 18.480 N TXNRD3 n/a
3 TRCN0000046493 CCACGGTATTTAGGAATCCAA pLKO.1 1059 CDS 100% 3.000 4.200 N TXNRD3 n/a
4 TRCN0000246174 ACAATTGAAGGAGTCTATAAC pLKO_005 1401 CDS 100% 13.200 10.560 N TXNRD3 n/a
5 TRCN0000246175 GTCTATGCTGTTGGTGATATT pLKO_005 1551 CDS 100% 13.200 9.240 N TXNRD3 n/a
6 TRCN0000246176 GGTGATAACCTTGAAGCTATT pLKO_005 2697 3UTR 100% 10.800 7.560 N TXNRD3 n/a
7 TRCN0000046497 GTCAGAAATCACTAATCAGAA pLKO.1 467 CDS 100% 4.950 3.465 N TXNRD3 n/a
8 TRCN0000046496 CATACTTTGTTCTGGCCTCTT pLKO.1 1773 CDS 100% 4.050 2.835 N TXNRD3 n/a
9 TRCN0000046495 GCACTTGTGTAAATGTAGGTT pLKO.1 736 CDS 100% 3.000 1.800 N TXNRD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.