Transcript: Human NM_052889.2

Homo sapiens caspase recruitment domain family member 16 (CARD16), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CARD16 (114769)
Length:
758
CDS:
28..321

Additional Resources:

NCBI RefSeq record:
NM_052889.2
NBCI Gene record:
CARD16 (114769)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417911 ACAAGACTCCCAATTACTATT pLKO_005 330 3UTR 100% 13.200 18.480 N CARD16 n/a
2 TRCN0000118457 CCTTGCATAAAGGATCTCTAT pLKO.1 605 3UTR 100% 4.950 6.930 N CARD16 n/a
3 TRCN0000118458 CAGGTCCGATACCTGGAAATT pLKO.1 299 CDS 100% 1.320 1.848 N CARD16 n/a
4 TRCN0000420033 AGAATCCCAGGTTTAGGTAAA pLKO_005 631 3UTR 100% 10.800 8.640 N CARD16 n/a
5 TRCN0000416502 GGAACTCATAAATTATCATAG pLKO_005 664 3UTR 100% 10.800 7.560 N CARD16 n/a
6 TRCN0000419010 GGAAATTAGCTTAGTACACAA pLKO_005 313 CDS 100% 4.950 3.465 N CARD16 n/a
7 TRCN0000436904 ACTCTCAGCAGGTCCGATACC pLKO_005 291 CDS 100% 1.350 0.945 N CARD16 n/a
8 TRCN0000118461 CCATGGGTGAAGGTACAATAA pLKO.1 74 CDS 100% 13.200 6.600 Y CARD16 n/a
9 TRCN0000118459 GCTTTGATTGACTCCGTTATT pLKO.1 193 CDS 100% 13.200 6.600 Y CARD16 n/a
10 TRCN0000118460 GAAGGTACAATAAATGGCTTA pLKO.1 82 CDS 100% 4.050 2.025 Y CARD16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.