Transcript: Human NM_052963.3

Homo sapiens DNA topoisomerase I mitochondrial (TOP1MT), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
TOP1MT (116447)
Length:
1942
CDS:
20..1825

Additional Resources:

NCBI RefSeq record:
NM_052963.3
NBCI Gene record:
TOP1MT (116447)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049425 GTTCGAGAAGTCGATGCAGAA pLKO.1 1444 CDS 100% 4.050 5.670 N TOP1MT n/a
2 TRCN0000292117 GTTCGAGAAGTCGATGCAGAA pLKO_005 1444 CDS 100% 4.050 5.670 N TOP1MT n/a
3 TRCN0000049426 GTACAAGAACTTACAGCTCTT pLKO.1 1168 CDS 100% 4.050 3.240 N TOP1MT n/a
4 TRCN0000292059 GTACAAGAACTTACAGCTCTT pLKO_005 1168 CDS 100% 4.050 3.240 N TOP1MT n/a
5 TRCN0000049424 GCCAGAGGATGTGGTTATCAA pLKO.1 661 CDS 100% 5.625 3.938 N TOP1MT n/a
6 TRCN0000292058 GCCAGAGGATGTGGTTATCAA pLKO_005 661 CDS 100% 5.625 3.938 N TOP1MT n/a
7 TRCN0000049427 GCAAGAGTTCGGCTACTGTAT pLKO.1 532 CDS 100% 4.950 3.465 N TOP1MT n/a
8 TRCN0000292118 GCAAGAGTTCGGCTACTGTAT pLKO_005 532 CDS 100% 4.950 3.465 N TOP1MT n/a
9 TRCN0000049423 CCACAGATACTTTGTGGACAA pLKO.1 442 CDS 100% 0.405 0.284 N TOP1MT n/a
10 TRCN0000292057 CCACAGATACTTTGTGGACAA pLKO_005 442 CDS 100% 0.405 0.284 N TOP1MT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.