Transcript: Human NM_052964.4

Homo sapiens cytokine dependent hematopoietic cell linker (CLNK), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CLNK (116449)
Length:
5502
CDS:
144..1430

Additional Resources:

NCBI RefSeq record:
NM_052964.4
NBCI Gene record:
CLNK (116449)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052964.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431410 TAGTTTCTTGGTCCGAGATTG pLKO_005 1133 CDS 100% 10.800 15.120 N CLNK n/a
2 TRCN0000413601 AGATAAGCTTAAGGGACTTAA pLKO_005 748 CDS 100% 13.200 10.560 N CLNK n/a
3 TRCN0000437346 GGTCATGGCCTCGCATCAATA pLKO_005 226 CDS 100% 13.200 10.560 N CLNK n/a
4 TRCN0000063259 GCCTGAATCAACTCATCTGTT pLKO.1 812 CDS 100% 4.950 3.960 N CLNK n/a
5 TRCN0000063261 GCCTCTCATAACACTTCCGAA pLKO.1 635 CDS 100% 2.640 2.112 N CLNK n/a
6 TRCN0000249676 TGAATGGTACATTGGAGAATA pLKO_005 1064 CDS 100% 13.200 9.240 N Clnk n/a
7 TRCN0000063258 CGGCCTATAAAGGAATCTGAA pLKO.1 408 CDS 100% 4.950 3.465 N CLNK n/a
8 TRCN0000063260 CCAGAACTTCAGTCTGCCAAA pLKO.1 200 CDS 100% 4.050 2.835 N CLNK n/a
9 TRCN0000063262 GCAGTTCTTCATTCACGACAA pLKO.1 871 CDS 100% 4.050 2.835 N CLNK n/a
10 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 2006 3UTR 100% 4.050 2.025 Y INTS7 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1952 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052964.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.