Transcript: Mouse NM_052977.5

Mus musculus adenosine deaminase, RNA-specific, B2 (Adarb2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Adarb2 (94191)
Length:
5633
CDS:
356..2593

Additional Resources:

NCBI RefSeq record:
NM_052977.5
NBCI Gene record:
Adarb2 (94191)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_052977.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119784 GCCGACCTGGAGATCATTAAT pLKO.1 2309 CDS 100% 15.000 12.000 N Adarb2 n/a
2 TRCN0000119782 GCAGCCAAAGTGAAAGCTATA pLKO.1 3158 3UTR 100% 10.800 8.640 N Adarb2 n/a
3 TRCN0000119786 GAGGTCCAAGAGGAAAGACAA pLKO.1 439 CDS 100% 4.950 3.960 N Adarb2 n/a
4 TRCN0000119785 GCAGGAATCGTCATGACCAAA pLKO.1 1544 CDS 100% 4.950 3.960 N Adarb2 n/a
5 TRCN0000119783 GACACGTTGTTCAAGGAGTTT pLKO.1 1016 CDS 100% 4.950 3.465 N Adarb2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3461 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052977.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.