Transcript: Human NM_053002.5

Homo sapiens mediator complex subunit 12L (MED12L), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
MED12L (116931)
Length:
10440
CDS:
130..6567

Additional Resources:

NCBI RefSeq record:
NM_053002.5
NBCI Gene record:
MED12L (116931)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_053002.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235010 CATTGCAACTCCGCCTAAATT pLKO_005 4682 CDS 100% 15.000 21.000 N MED12L n/a
2 TRCN0000235011 AGATTGTTGCTTCGTACTTAA pLKO_005 7183 3UTR 100% 13.200 18.480 N MED12L n/a
3 TRCN0000052982 GCCTCCTAATTACTCGCCTAT pLKO.1 5505 CDS 100% 4.050 5.670 N MED12L n/a
4 TRCN0000235008 ACTGAACATCAACGGACTAAT pLKO_005 2649 CDS 100% 13.200 10.560 N MED12L n/a
5 TRCN0000052978 GCACTGTTCTTAGTTCAGAAT pLKO.1 3254 CDS 100% 4.950 3.960 N MED12L n/a
6 TRCN0000052980 CGGACTAATTGACTTCGCAAT pLKO.1 2661 CDS 100% 4.050 3.240 N MED12L n/a
7 TRCN0000235009 ACGATACCAAGATGACATAAA pLKO_005 4638 CDS 100% 13.200 9.240 N MED12L n/a
8 TRCN0000235007 GATGACTTGTGCCTATTATTC pLKO_005 612 CDS 100% 13.200 9.240 N MED12L n/a
9 TRCN0000052981 CCCATCAAAGATTGGAGCTTA pLKO.1 324 CDS 100% 4.950 3.465 N MED12L n/a
10 TRCN0000052979 GCGATCAGAAAGTATTGACAA pLKO.1 4968 CDS 100% 4.950 3.465 N MED12L n/a
11 TRCN0000234151 GAACATGGCTCAGCCAGAAAC pLKO_005 292 CDS 100% 10.800 6.480 N Med12l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053002.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.