Transcript: Mouse NM_053015.3

Mus musculus melanophilin (Mlph), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mlph (171531)
Length:
4484
CDS:
179..1951

Additional Resources:

NCBI RefSeq record:
NM_053015.3
NBCI Gene record:
Mlph (171531)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249800 TTAACCCGATCCTCGACTTTG pLKO_005 2265 3UTR 100% 10.800 15.120 N Mlph n/a
2 TRCN0000257966 TTGGAGTTGAACAAGCGAATG pLKO_005 1199 CDS 100% 6.000 8.400 N Mlph n/a
3 TRCN0000249802 TGCTAGTCCACCTGGAGAATA pLKO_005 1236 CDS 100% 13.200 9.240 N Mlph n/a
4 TRCN0000249801 AGTCAGGCATCCCGATCTTTC pLKO_005 1668 CDS 100% 10.800 7.560 N Mlph n/a
5 TRCN0000249799 GTGCAGCCATGTAGCCCTTTA pLKO_005 953 CDS 100% 10.800 7.560 N Mlph n/a
6 TRCN0000180795 GCTGTGATTCTTTAACCCGAT pLKO.1 2254 3UTR 100% 2.160 1.512 N Mlph n/a
7 TRCN0000153010 GATGTGGACTTTGAGGAAGAA pLKO.1 755 CDS 100% 4.950 2.970 N AAMP n/a
8 TRCN0000281128 GATGTGGACTTTGAGGAAGAA pLKO_005 755 CDS 100% 4.950 2.970 N AAMP n/a
9 TRCN0000128005 GATCGGAAATCAGTGTACCGA pLKO.1 1844 CDS 100% 0.750 0.450 N MLPH n/a
10 TRCN0000318998 GATCGGAAATCAGTGTACCGA pLKO_005 1844 CDS 100% 0.750 0.450 N MLPH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.