Transcript: Mouse NM_053099.2

Mus musculus SET binding protein 1 (Setbp1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Setbp1 (240427)
Length:
9981
CDS:
370..5118

Additional Resources:

NCBI RefSeq record:
NM_053099.2
NBCI Gene record:
Setbp1 (240427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095085 CCACGCAAGTTCTCATGTAAA pLKO.1 3627 CDS 100% 13.200 18.480 N Setbp1 n/a
2 TRCN0000095086 GCAGCATCTATCGAAAGTAAA pLKO.1 2446 CDS 100% 13.200 18.480 N Setbp1 n/a
3 TRCN0000358516 TATTACCCGGTGCCATATATC pLKO_005 3319 CDS 100% 13.200 18.480 N SETBP1 n/a
4 TRCN0000095084 CGGCTTTGAATCCCAATCATT pLKO.1 5930 3UTR 100% 5.625 7.875 N Setbp1 n/a
5 TRCN0000095087 GCCTATGATGAACCTTGGTTA pLKO.1 3516 CDS 100% 4.950 3.960 N Setbp1 n/a
6 TRCN0000095088 GCTGGATAAGAAGACCATCAA pLKO.1 2313 CDS 100% 4.950 3.465 N Setbp1 n/a
7 TRCN0000016908 CCTATGATGAACCTTGGTTAT pLKO.1 3517 CDS 100% 10.800 8.640 N SETBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.