Transcript: Mouse NM_053100.2

Mus musculus tripartite motif-containing 8 (Trim8), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Trim8 (93679)
Length:
3262
CDS:
797..2452

Additional Resources:

NCBI RefSeq record:
NM_053100.2
NBCI Gene record:
Trim8 (93679)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238180 GGAGTTGGGACAGTATCTTAA pLKO_005 2706 3UTR 100% 13.200 18.480 N Trim8 n/a
2 TRCN0000033964 GCCGCAAGATTCTCGTCTGTT pLKO.1 2181 CDS 100% 4.950 6.930 N TRIM8 n/a
3 TRCN0000238179 GCCGCAAGATTCTCGTCTGTT pLKO_005 2181 CDS 100% 4.950 6.930 N Trim8 n/a
4 TRCN0000331155 GCCGCAAGATTCTCGTCTGTT pLKO_005 2181 CDS 100% 4.950 6.930 N TRIM8 n/a
5 TRCN0000033967 GCAGCCGTCCACCAAACACTA pLKO.1 2419 CDS 100% 1.650 2.310 N TRIM8 n/a
6 TRCN0000238178 AGCCGTCCACCAAACACTATG pLKO_005 2421 CDS 100% 10.800 8.640 N Trim8 n/a
7 TRCN0000295953 AGGATTTCTACAGGGTGTATG pLKO_005 2397 CDS 100% 10.800 8.640 N TRIM8 n/a
8 TRCN0000039415 GCTGCCATGCAAACATAACTT pLKO.1 877 CDS 100% 5.625 3.938 N Trim8 n/a
9 TRCN0000039418 CAGTTGCGGAAGATGCTAGAA pLKO.1 1823 CDS 100% 4.950 3.465 N Trim8 n/a
10 TRCN0000238177 GTGCAACCAGGCCTACAATCA pLKO_005 958 CDS 100% 4.950 3.465 N Trim8 n/a
11 TRCN0000039417 CAGGAGTATTCACACCCACTT pLKO.1 2294 CDS 100% 4.050 2.835 N Trim8 n/a
12 TRCN0000039414 CCAGGATTTCTACAGGGTGTA pLKO.1 2395 CDS 100% 4.050 2.835 N Trim8 n/a
13 TRCN0000238176 CCAGTACTGCTGCTACTACAG pLKO_005 1288 CDS 100% 4.050 2.835 N Trim8 n/a
14 TRCN0000370605 CCAGTACTGCTGCTACTACAG pLKO_005 1288 CDS 100% 4.050 2.835 N TRIM8 n/a
15 TRCN0000039416 GAGGAATGAGATACGGAAGAT pLKO.1 1351 CDS 100% 4.950 2.970 N Trim8 n/a
16 TRCN0000295956 ACATCGTGGAGAAGTTCAATG pLKO_005 1014 CDS 100% 10.800 7.560 N TRIM8 n/a
17 TRCN0000295954 TTGAGGACCAGCTGTACAAAC pLKO_005 1416 CDS 100% 10.800 7.560 N TRIM8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.