Transcript: Mouse NM_053106.2

Mus musculus leiomodin 1 (smooth muscle) (Lmod1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Lmod1 (93689)
Length:
3942
CDS:
198..1985

Additional Resources:

NCBI RefSeq record:
NM_053106.2
NBCI Gene record:
Lmod1 (93689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053106.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090143 CGGCACGATTTCTTTCTGATT pLKO.1 3301 3UTR 100% 4.950 6.930 N Lmod1 n/a
2 TRCN0000090144 CCATCCGTTCTAGCAACCTTA pLKO.1 1924 CDS 100% 4.950 3.465 N Lmod1 n/a
3 TRCN0000090146 CCCTTATCATGGAGAACCTAA pLKO.1 1813 CDS 100% 4.950 3.465 N Lmod1 n/a
4 TRCN0000090147 GCTCCCAGCATATTTGATGAA pLKO.1 1122 CDS 100% 4.950 3.465 N Lmod1 n/a
5 TRCN0000090145 GCAGAGGAATCAAACGGACAA pLKO.1 347 CDS 100% 4.050 2.835 N Lmod1 n/a
6 TRCN0000113868 CGTCAACAACTCAGACTGCAT pLKO.1 1190 CDS 100% 2.640 1.848 N LMOD1 n/a
7 TRCN0000113870 CCCTTATCATGGAGAACCTGA pLKO.1 1813 CDS 100% 2.640 1.848 N LMOD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053106.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.