Transcript: Mouse NM_053117.3

Mus musculus par-6 family cell polarity regulator gamma (Pard6g), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pard6g (93737)
Length:
3143
CDS:
177..1325

Additional Resources:

NCBI RefSeq record:
NM_053117.3
NBCI Gene record:
Pard6g (93737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053117.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428295 TTCGAGTCTTCATCCAGAAAC pLKO_005 448 CDS 100% 10.800 8.640 N Pard6g n/a
2 TRCN0000420532 CATCATTCCTACAACCTTATT pLKO_005 1512 3UTR 100% 13.200 9.240 N Pard6g n/a
3 TRCN0000429741 GCATGTAGTACTGTTAGATAT pLKO_005 1403 3UTR 100% 13.200 9.240 N Pard6g n/a
4 TRCN0000436575 GGCTCTACAGACACGGTTATG pLKO_005 655 CDS 100% 10.800 7.560 N Pard6g n/a
5 TRCN0000113098 GAAGCCGACATTGTCATTGAA pLKO.1 1062 CDS 100% 5.625 3.938 N Pard6g n/a
6 TRCN0000113097 GTGGAAGTCAAGAGCAAGTTT pLKO.1 231 CDS 100% 5.625 3.938 N Pard6g n/a
7 TRCN0000149232 GTGGAAGTCAAGAGCAAGTTT pLKO.1 231 CDS 100% 5.625 3.938 N PARD6G n/a
8 TRCN0000113096 GCCCATCAACAATGACGACAA pLKO.1 392 CDS 100% 4.050 2.835 N Pard6g n/a
9 TRCN0000113099 CCAGGTATCTTCATTTCTCGA pLKO.1 747 CDS 100% 2.640 1.848 N Pard6g n/a
10 TRCN0000113095 CGTGGGTGAATGTGCATGTTA pLKO.1 2161 3UTR 100% 5.625 3.375 N Pard6g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053117.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.