Transcript: Mouse NM_053188.2

Mus musculus steroid 5 alpha-reductase 2 (Srd5a2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Srd5a2 (94224)
Length:
854
CDS:
90..854

Additional Resources:

NCBI RefSeq record:
NM_053188.2
NBCI Gene record:
Srd5a2 (94224)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039181 GCCTTTATCAGCGGTGATCTT pLKO.1 404 CDS 100% 4.950 6.930 N Srd5a2 n/a
2 TRCN0000039179 CCTGGTTTATTGCGCGGAATA pLKO.1 476 CDS 100% 10.800 7.560 N Srd5a2 n/a
3 TRCN0000039183 GCCAATTTCCTGGGCGAGATT pLKO.1 663 CDS 100% 4.950 3.465 N Srd5a2 n/a
4 TRCN0000039180 CGTCGGTGTCTTCTTCTTTAT pLKO.1 530 CDS 100% 13.200 7.920 N Srd5a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.