Transcript: Mouse NM_053217.2

Mus musculus interferon induced protein with tetratricopeptide repeats 1B like 2 (Ifit1bl2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Ifit1bl2 (112419)
Length:
3365
CDS:
202..1602

Additional Resources:

NCBI RefSeq record:
NM_053217.2
NBCI Gene record:
Ifit1bl2 (112419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053217.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267663 ATCATGCCATTTGGCTATATG pLKO_005 1143 CDS 100% 13.200 18.480 N Ifit1bl2 n/a
2 TRCN0000267664 TTACCTGGGAGCTGGACATAA pLKO_005 290 CDS 100% 13.200 9.240 N Ifit1bl2 n/a
3 TRCN0000267722 GAAGTGTTGAGCATGAGTAAC pLKO_005 1276 CDS 100% 10.800 7.560 N Ifit1bl2 n/a
4 TRCN0000267725 TGTATACAAGTGGTTGATTTC pLKO_005 2086 3UTR 100% 10.800 7.560 N Ifit1bl2 n/a
5 TRCN0000201102 CCCTTGTTTATCCCAGTTGTT pLKO.1 3170 3UTR 100% 4.950 3.465 N Ifit1bl2 n/a
6 TRCN0000192800 GCATGAGTAACTTGGGAGATT pLKO.1 1286 CDS 100% 4.950 3.465 N Ifit1bl2 n/a
7 TRCN0000216119 CATGAGTGAAGAATCTCATAA pLKO.1 228 CDS 100% 1.320 0.924 N Ifit1bl2 n/a
8 TRCN0000267662 CCTAAAGCTGCAGGATTTAAG pLKO_005 867 CDS 100% 13.200 7.920 N Ifit1bl2 n/a
9 TRCN0000216244 CAATCATGCCATTTGGCTATA pLKO.1 1141 CDS 100% 10.800 6.480 N Ifit1bl2 n/a
10 TRCN0000201368 GCAGCCATCACACATTACTTA pLKO.1 1372 CDS 100% 5.625 2.813 Y Ifit1bl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053217.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.