Transcript: Mouse NM_053244.5

Mus musculus KISS1 receptor (Kiss1r), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Kiss1r (114229)
Length:
3163
CDS:
1704..2894

Additional Resources:

NCBI RefSeq record:
NM_053244.5
NBCI Gene record:
Kiss1r (114229)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053244.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439285 CAACCTGCTGGCTCTATATCT pLKO_005 2324 CDS 100% 5.625 3.938 N Kiss1r n/a
2 TRCN0000027516 CATGTGCAAATTCGTCAACTA pLKO.1 2042 CDS 100% 4.950 3.465 N Kiss1r n/a
3 TRCN0000027502 CGGAAACTCATTGGTCATCTA pLKO.1 1877 CDS 100% 4.950 3.465 N Kiss1r n/a
4 TRCN0000027529 GCAGACAGTTACCAACTTCTA pLKO.1 1922 CDS 100% 4.950 3.465 N Kiss1r n/a
5 TRCN0000437623 AGACGTCACTTTCCTACTGTG pLKO_005 1964 CDS 100% 4.050 2.835 N Kiss1r n/a
6 TRCN0000027544 GCACATGCAGACAGTTACCAA pLKO.1 1916 CDS 100% 3.000 2.100 N Kiss1r n/a
7 TRCN0000027503 GTAAAGCATCCCAGGCTGCTT pLKO.1 2913 3UTR 100% 0.264 0.185 N Kiss1r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053244.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.