Transcript: Human NM_054023.5

Homo sapiens secretoglobin family 3A member 2 (SCGB3A2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SCGB3A2 (117156)
Length:
516
CDS:
94..375

Additional Resources:

NCBI RefSeq record:
NM_054023.5
NBCI Gene record:
SCGB3A2 (117156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_054023.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373477 GGGCTAAGGAAGTGTGTAAAT pLKO_005 289 CDS 100% 13.200 18.480 N SCGB3A2 n/a
2 TRCN0000083898 AGATAAAGAGCGGAGGTGGAT pLKO.1 381 3UTR 100% 2.640 3.696 N SCGB3A2 n/a
3 TRCN0000083899 GCCTTTGTAGTTACTCTGCTA pLKO.1 131 CDS 100% 2.640 3.696 N SCGB3A2 n/a
4 TRCN0000083900 GTTGACAAGTTGGCACCTTTA pLKO.1 184 CDS 100% 10.800 7.560 N SCGB3A2 n/a
5 TRCN0000083901 CCATTAAAGCTTCTTCTGAAA pLKO.1 235 CDS 100% 4.950 3.465 N SCGB3A2 n/a
6 TRCN0000373478 AGAAACTGCTGGAGGCGCTAT pLKO_005 341 CDS 100% 4.050 2.835 N SCGB3A2 n/a
7 TRCN0000373405 TTCTGTTGAGCACCTTGTGGA pLKO_005 267 CDS 100% 2.640 1.848 N SCGB3A2 n/a
8 TRCN0000083902 CCTTTACCTCTGGACAACATT pLKO.1 199 CDS 100% 5.625 3.375 N SCGB3A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054023.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.