Transcript: Mouse NM_054054.2

Mus musculus bromodomain, testis-specific (Brdt), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Brdt (114642)
Length:
4710
CDS:
308..3178

Additional Resources:

NCBI RefSeq record:
NM_054054.2
NBCI Gene record:
Brdt (114642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_054054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362399 AGGTGATTGCAAGCGAGTATT pLKO_005 2623 CDS 100% 13.200 18.480 N Brdt n/a
2 TRCN0000362398 TGACTATTACACCATCATAAA pLKO_005 496 CDS 100% 13.200 18.480 N Brdt n/a
3 TRCN0000088726 CGATGAACCTATTGAGAGTAT pLKO.1 1435 CDS 100% 4.950 6.930 N Brdt n/a
4 TRCN0000088727 GCCTATGAACTACGATGAGAA pLKO.1 1819 CDS 100% 4.950 6.930 N Brdt n/a
5 TRCN0000362480 TCGCAGTCTCTGGTCCAAATT pLKO_005 905 CDS 100% 13.200 10.560 N Brdt n/a
6 TRCN0000362397 CAAAGTAACGGAGCAATTAAA pLKO_005 1105 CDS 100% 15.000 10.500 N Brdt n/a
7 TRCN0000088724 CCTGACTATTACACCATCATA pLKO.1 494 CDS 100% 5.625 3.938 N Brdt n/a
8 TRCN0000088725 GCCAAGAAACATTTGCCGTAT pLKO.1 1157 CDS 100% 4.050 2.835 N Brdt n/a
9 TRCN0000088723 CCTCAACTTTAAATGAAAGGT pLKO.1 3199 3UTR 100% 3.000 2.100 N Brdt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.