Transcript: Mouse NM_054055.2

Mus musculus solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 (Slc13a3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc13a3 (114644)
Length:
3224
CDS:
37..1839

Additional Resources:

NCBI RefSeq record:
NM_054055.2
NBCI Gene record:
Slc13a3 (114644)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_054055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416004 TGGAACTTGCACCGGAGAATC pLKO_005 352 CDS 100% 10.800 15.120 N Slc13a3 n/a
2 TRCN0000416719 GACGCAGAGGATCAGGCTAAA pLKO_005 985 CDS 100% 10.800 8.640 N Slc13a3 n/a
3 TRCN0000070198 GCTGTCCTTATTCCTGTTAAA pLKO.1 2857 3UTR 100% 13.200 9.240 N Slc13a3 n/a
4 TRCN0000420614 GCAAAGCTGAAATGGCATTTG pLKO_005 2150 3UTR 100% 10.800 7.560 N Slc13a3 n/a
5 TRCN0000070201 CCCTGGAACATTATCCTTCTT pLKO.1 1306 CDS 100% 4.950 3.465 N Slc13a3 n/a
6 TRCN0000070200 GCCTTGACCAACAACACAGTT pLKO.1 1807 CDS 100% 4.950 3.465 N Slc13a3 n/a
7 TRCN0000070202 CCTCTATGTCATCCTGCTCAT pLKO.1 159 CDS 100% 4.050 2.835 N Slc13a3 n/a
8 TRCN0000070199 CCACAGTGTGATGTGGTGAAT pLKO.1 832 CDS 100% 0.495 0.347 N Slc13a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.