Transcript: Mouse NM_054056.2

Mus musculus PRKC, apoptosis, WT1, regulator (Pawr), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pawr (114774)
Length:
1828
CDS:
190..1191

Additional Resources:

NCBI RefSeq record:
NM_054056.2
NBCI Gene record:
Pawr (114774)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_054056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376336 TTGGCCTACAATGCCTTATTA pLKO_005 1575 3UTR 100% 15.000 21.000 N Pawr n/a
2 TRCN0000367108 TATCTACGTTAGCCCATATTC pLKO_005 1499 3UTR 100% 13.200 18.480 N Pawr n/a
3 TRCN0000367178 GTGAGGCTGATGCAAGATAAA pLKO_005 1036 CDS 100% 13.200 10.560 N Pawr n/a
4 TRCN0000367110 ACTCAAGGAAGAGATCGATTT pLKO_005 1074 CDS 100% 10.800 7.560 N Pawr n/a
5 TRCN0000376276 AGAACAGTTCCAGGCAGATAC pLKO_005 826 CDS 100% 10.800 7.560 N Pawr n/a
6 TRCN0000075602 GAAGTTGTAAGAGAAAGGCAA pLKO.1 1000 CDS 100% 2.640 1.848 N Pawr n/a
7 TRCN0000376275 AGAAGATGAAATCTCAAATAG pLKO_005 867 CDS 100% 13.200 7.920 N Pawr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.