Transcript: Mouse NM_054060.1

Mus musculus pregnancy-specific glycoprotein 25 (Psg25), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Psg25 (114868)
Length:
3089
CDS:
180..1607

Additional Resources:

NCBI RefSeq record:
NM_054060.1
NBCI Gene record:
Psg25 (114868)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_054060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125765 GCATAACACTCATGGCTTTAA pLKO.1 1112 CDS 100% 13.200 10.560 N Psg25 n/a
2 TRCN0000125767 CTGGTACAGAGGGTTGCTAAA pLKO.1 377 CDS 100% 10.800 7.560 N Psg25 n/a
3 TRCN0000125764 GCCTTCCAACTTGTTTATCTT pLKO.1 1857 3UTR 100% 5.625 3.938 N Psg25 n/a
4 TRCN0000125766 CCAGAGTCATCATCCATTCTT pLKO.1 280 CDS 100% 5.625 3.375 N Psg25 n/a
5 TRCN0000125768 CCTGGTACAAAGGTGTGCATA pLKO.1 1096 CDS 100% 4.950 2.970 N Psg25 n/a
6 TRCN0000065532 CCCTACGAACTCTGAATAGAT pLKO.1 901 CDS 100% 5.625 2.813 Y Psg19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.