Transcript: Human NM_057167.3

Homo sapiens collagen type VI alpha 3 chain (COL6A3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
COL6A3 (1293)
Length:
9981
CDS:
286..9201

Additional Resources:

NCBI RefSeq record:
NM_057167.3
NBCI Gene record:
COL6A3 (1293)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_057167.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003622 GCTTTGCACATATTCGAGATT pLKO.1 4019 CDS 100% 4.950 6.930 N COL6A3 n/a
2 TRCN0000003624 CGCGACTTTGTAATGAACCTA pLKO.1 1642 CDS 100% 3.000 4.200 N COL6A3 n/a
3 TRCN0000003625 CCTTAATCTATGTGCACCGTT pLKO.1 9759 3UTR 100% 2.640 3.696 N COL6A3 n/a
4 TRCN0000003623 GCCCTCATCCAAAGCATCAAA pLKO.1 6799 CDS 100% 5.625 3.938 N COL6A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_057167.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.