Transcript: Human NM_058175.2

Homo sapiens collagen type VI alpha 2 chain (COL6A2), transcript variant 2C2a', mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
COL6A2 (1292)
Length:
3461
CDS:
83..2569

Additional Resources:

NCBI RefSeq record:
NM_058175.2
NBCI Gene record:
COL6A2 (1292)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_058175.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444475 TCACGGAGTGTGACGTCATGA pLKO_005 1848 CDS 100% 4.950 6.930 N COL6A2 n/a
2 TRCN0000446991 TGCGCAACATGACGCTGTTCT pLKO_005 2430 CDS 100% 4.950 6.930 N COL6A2 n/a
3 TRCN0000116848 GCCGGACACTACCGAGAGAAA pLKO.1 163 CDS 100% 1.650 2.310 N COL6A2 n/a
4 TRCN0000116847 CGCATCATCAAGGTCATGAAA pLKO.1 779 CDS 100% 5.625 3.938 N COL6A2 n/a
5 TRCN0000116851 CGCTGAGAAGTTCATCGATGA pLKO.1 2461 CDS 100% 4.050 2.835 N COL6A2 n/a
6 TRCN0000116849 CTTCGTCATCAACGTGGTCAA pLKO.1 1990 CDS 100% 4.050 2.835 N COL6A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_058175.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.