Transcript: Human NM_078485.4

Homo sapiens collagen type IX alpha 1 chain (COL9A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
COL9A1 (1297)
Length:
4018
CDS:
146..2182

Additional Resources:

NCBI RefSeq record:
NM_078485.4
NBCI Gene record:
COL9A1 (1297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_078485.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083365 GCAGGTTTGCATGAGAGTCAT pLKO.1 1705 CDS 100% 4.950 6.930 N COL9A1 n/a
2 TRCN0000371969 CCTCAGTTGCAGTAGTTATTT pLKO_005 2552 3UTR 100% 15.000 10.500 N COL9A1 n/a
3 TRCN0000371971 GTATTACCTTCAGTATGATTA pLKO_005 2295 3UTR 100% 13.200 9.240 N COL9A1 n/a
4 TRCN0000083363 GCTATTCAGTAAGTTCTCTTT pLKO.1 2354 3UTR 100% 4.950 3.465 N COL9A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_078485.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.