Transcript: Mouse NM_080437.2

Mus musculus cadherin, EGF LAG seven-pass G-type receptor 3 (Celsr3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Celsr3 (107934)
Length:
11558
CDS:
1..9906

Additional Resources:

NCBI RefSeq record:
NM_080437.2
NBCI Gene record:
Celsr3 (107934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094951 CGCTCATATAATGTACCAGAT pLKO.1 3270 CDS 100% 4.050 5.670 N Celsr3 n/a
2 TRCN0000094953 GCCAATGGTTTGGTGCATTAT pLKO.1 1699 CDS 100% 13.200 9.240 N Celsr3 n/a
3 TRCN0000094952 CCCAATATCATGCTCAGCATT pLKO.1 6931 CDS 100% 4.950 3.465 N Celsr3 n/a
4 TRCN0000094949 CCTCTTTGTTTACAAGTGAAA pLKO.1 11065 3UTR 100% 4.950 3.465 N Celsr3 n/a
5 TRCN0000094950 GCTCATATAATGTACCAGATT pLKO.1 3271 CDS 100% 4.950 3.465 N Celsr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.