Transcript: Mouse NM_080556.3

Mus musculus transmembrane 9 superfamily member 2 (Tm9sf2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tm9sf2 (68059)
Length:
3062
CDS:
187..2175

Additional Resources:

NCBI RefSeq record:
NM_080556.3
NBCI Gene record:
Tm9sf2 (68059)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328466 CCGTATAAGTTTACGTTTAAT pLKO_005 508 CDS 100% 15.000 21.000 N Tm9sf2 n/a
2 TRCN0000328467 GCGTCTAGGTGGGACTATATT pLKO_005 1033 CDS 100% 15.000 21.000 N Tm9sf2 n/a
3 TRCN0000193250 CTCACCGTATAAGTTTACGTT pLKO.1 504 CDS 100% 3.000 4.200 N Tm9sf2 n/a
4 TRCN0000175124 CGGTAGGTGGAAAGAATTATT pLKO.1 2540 3UTR 100% 15.000 10.500 N Tm9sf2 n/a
5 TRCN0000328404 CGGTAGGTGGAAAGAATTATT pLKO_005 2540 3UTR 100% 15.000 10.500 N Tm9sf2 n/a
6 TRCN0000174326 CCACCAGATGTATTACATGTT pLKO.1 1827 CDS 100% 4.950 3.465 N Tm9sf2 n/a
7 TRCN0000353550 CCACCAGATGTATTACATGTT pLKO_005 1827 CDS 100% 4.950 3.465 N Tm9sf2 n/a
8 TRCN0000174519 CCTTATGAATATACAGCGTTT pLKO.1 406 CDS 100% 4.050 2.835 N Tm9sf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.