Transcript: Mouse NM_080558.4

Mus musculus sperm specific antigen 2 (Ssfa2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ssfa2 (70599)
Length:
5109
CDS:
116..3874

Additional Resources:

NCBI RefSeq record:
NM_080558.4
NBCI Gene record:
Ssfa2 (70599)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080558.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219587 AGTAGGGCGTAGCCTAATAAA pLKO.1 2239 CDS 100% 15.000 21.000 N Ssfa2 n/a
2 TRCN0000178172 GCCAGAGGCATAGACATTAAA pLKO.1 740 CDS 100% 15.000 21.000 N Ssfa2 n/a
3 TRCN0000178193 CGGAGAGTGTTGCATGATATT pLKO.1 2843 CDS 100% 13.200 10.560 N Ssfa2 n/a
4 TRCN0000178221 GAAAGCCGACAACCAAGATTT pLKO.1 1879 CDS 100% 13.200 9.240 N Ssfa2 n/a
5 TRCN0000178222 GCAGGAGCGTAGATAACTTAT pLKO.1 3261 CDS 100% 13.200 9.240 N Ssfa2 n/a
6 TRCN0000177721 CCACACACCATATTCTCAGAT pLKO.1 2085 CDS 100% 4.950 3.465 N Ssfa2 n/a
7 TRCN0000178146 GAAGCCAATCACCTACATGAA pLKO.1 470 CDS 100% 4.950 3.465 N Ssfa2 n/a
8 TRCN0000178170 GCAGAAAGACTCCTTTGAGAT pLKO.1 1498 CDS 100% 4.950 3.465 N Ssfa2 n/a
9 TRCN0000178171 GCTAAGTCTTGCCAAGTCAAA pLKO.1 1573 CDS 100% 4.950 3.465 N Ssfa2 n/a
10 TRCN0000178329 GTCTTCTGTCAATGTGCGATT pLKO.1 2365 CDS 100% 4.050 2.835 N Ssfa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080558.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.