Transcript: Human NM_080601.3

Homo sapiens protein tyrosine phosphatase non-receptor type 11 (PTPN11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
PTPN11 (5781)
Length:
1838
CDS:
166..1548

Additional Resources:

NCBI RefSeq record:
NM_080601.3
NBCI Gene record:
PTPN11 (5781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005003 CGCTAAGAGAACTTAAACTTT pLKO.1 1355 CDS 100% 5.625 7.875 N PTPN11 n/a
2 TRCN0000350368 CGCTAAGAGAACTTAAACTTT pLKO_005 1355 CDS 100% 5.625 7.875 N PTPN11 n/a
3 TRCN0000029877 CGTGTTAGGAACGTCAAAGAA pLKO.1 1315 CDS 100% 5.625 7.875 N Ptpn11 n/a
4 TRCN0000327986 CGTGTTAGGAACGTCAAAGAA pLKO_005 1315 CDS 100% 5.625 7.875 N Ptpn11 n/a
5 TRCN0000355887 AGTCTAAAGTGACCCATGTTA pLKO_005 656 CDS 100% 5.625 3.938 N PTPN11 n/a
6 TRCN0000005006 GCAAATATCATCATGCCTGAA pLKO.1 1084 CDS 100% 4.050 2.835 N PTPN11 n/a
7 TRCN0000355818 AGATGTCATTGAGCTTAAATA pLKO_005 444 CDS 100% 15.000 9.000 N PTPN11 n/a
8 TRCN0000005004 GCTGAAATAGAAAGCAGAGTT pLKO.1 835 CDS 100% 4.950 2.970 N PTPN11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.