Transcript: Human NM_080612.4

Homo sapiens GRB2 associated binding protein 3 (GAB3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
GAB3 (139716)
Length:
4742
CDS:
53..1813

Additional Resources:

NCBI RefSeq record:
NM_080612.4
NBCI Gene record:
GAB3 (139716)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080612.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180602 GCCCTTACGTGGACAAAGAAA pLKO.1 1616 CDS 100% 5.625 7.875 N GAB3 n/a
2 TRCN0000180562 GACCCAAACACTAATGCCGTA pLKO.1 530 CDS 100% 2.160 3.024 N GAB3 n/a
3 TRCN0000179872 CAAGACTACTTCCCGTACATT pLKO.1 316 CDS 100% 5.625 4.500 N GAB3 n/a
4 TRCN0000146923 CAAGCGGCTTAGTTTGAATTT pLKO.1 1153 CDS 100% 13.200 9.240 N GAB3 n/a
5 TRCN0000422272 TTGACTCCAATACCTGAAATT pLKO_005 2119 3UTR 100% 13.200 9.240 N GAB3 n/a
6 TRCN0000421776 GAATCTCCCTCTCTGGTTTAG pLKO_005 1077 CDS 100% 10.800 7.560 N GAB3 n/a
7 TRCN0000100173 CAGATGTGATAGCTGGTCAAA pLKO.1 655 CDS 100% 4.950 3.465 N Gab3 n/a
8 TRCN0000148678 CCACTTGTCTTCTTCACCATT pLKO.1 856 CDS 100% 4.950 3.465 N GAB3 n/a
9 TRCN0000179952 CCCTGATGACTACATTCCAAT pLKO.1 1282 CDS 100% 4.950 3.465 N GAB3 n/a
10 TRCN0000180927 GCAGACACAATGACCAGGAAA pLKO.1 2924 3UTR 100% 4.950 3.465 N GAB3 n/a
11 TRCN0000100174 CCAGATGTGATAGCTGGTCAA pLKO.1 654 CDS 100% 4.050 2.835 N Gab3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080612.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.