Transcript: Human NM_080647.1

Homo sapiens T-box transcription factor 1 (TBX1), transcript variant C, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TBX1 (6899)
Length:
2082
CDS:
130..1617

Additional Resources:

NCBI RefSeq record:
NM_080647.1
NBCI Gene record:
TBX1 (6899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232143 CGCAAAGATAGCGAGAAATAT pLKO_005 874 CDS 100% 15.000 21.000 N TBX1 n/a
2 TRCN0000232142 TGGATCCCATGGCCGACTATA pLKO_005 578 CDS 100% 13.200 18.480 N TBX1 n/a
3 TRCN0000232144 GGATCACGCAGCTCAAGATTG pLKO_005 968 CDS 100% 10.800 15.120 N TBX1 n/a
4 TRCN0000257296 GGACGACAACGGCCACATTAT pLKO_005 798 CDS 100% 13.200 9.240 N TBX1 n/a
5 TRCN0000014757 CAGCTCAAGATTGCCAGCAAT pLKO.1 976 CDS 100% 4.950 3.465 N TBX1 n/a
6 TRCN0000014755 CCACGCAAAGATAGCGAGAAA pLKO.1 871 CDS 100% 4.950 3.465 N TBX1 n/a
7 TRCN0000014754 CGAGAAATATGCCGAGGAGAA pLKO.1 885 CDS 100% 4.050 2.835 N TBX1 n/a
8 TRCN0000014756 GCCGGTGAAGAAGAACGCGAA pLKO.1 426 CDS 100% 0.720 0.504 N TBX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.