Transcript: Human NM_080705.4

Homo sapiens transient receptor potential cation channel subfamily V member 1 (TRPV1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TRPV1 (7442)
Length:
4090
CDS:
202..2721

Additional Resources:

NCBI RefSeq record:
NM_080705.4
NBCI Gene record:
TRPV1 (7442)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080705.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044189 CCGTTTCATGTTTGTCTACAT pLKO.1 1935 CDS 100% 4.950 3.960 N TRPV1 n/a
2 TRCN0000044192 GAAGTTTATCTGCGACAGTTT pLKO.1 2635 CDS 100% 4.950 3.465 N TRPV1 n/a
3 TRCN0000044190 GCGCATCTTCTACTTCAACTT pLKO.1 1497 CDS 100% 4.950 3.465 N TRPV1 n/a
4 TRCN0000044191 GCTCACCAACAAGAAGGGAAT pLKO.1 1185 CDS 100% 4.050 2.835 N TRPV1 n/a
5 TRCN0000044188 GCTCAGAATAACTGCCAGGAT pLKO.1 568 CDS 100% 2.640 1.848 N TRPV1 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3285 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3285 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080705.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.