Transcript: Mouse NM_133192.3

Mus musculus neuropeptide FF receptor 2 (Npffr2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Npffr2 (104443)
Length:
1643
CDS:
116..1369

Additional Resources:

NCBI RefSeq record:
NM_133192.3
NBCI Gene record:
Npffr2 (104443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133192.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027453 CCATCTGCAATAATGTTACAT pLKO.1 644 CDS 100% 5.625 7.875 N Npffr2 n/a
2 TRCN0000027471 GCGAAACGCAACATAGTCATA pLKO.1 1205 CDS 100% 4.950 6.930 N Npffr2 n/a
3 TRCN0000027484 GCATCACTGGTATTCAGATAT pLKO.1 184 CDS 100% 13.200 9.240 N Npffr2 n/a
4 TRCN0000027446 GCGTATCATCAACATCTACAT pLKO.1 1033 CDS 100% 4.950 3.465 N Npffr2 n/a
5 TRCN0000027462 GCCTATCACATTGCTGGACAA pLKO.1 412 CDS 100% 4.050 2.835 N Npffr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133192.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.